GGrantIndex
← Search

Cellular and Molecular Biology Core

$170,497P01FY2009HLNIH

Wake Forest University Health Sciences, Winston-Salem NC

Investigators

Linked publications & trials

Abstract

The responsibilities of Core B will involve the performance of two separate but related functions: 1) The Tissue Culture unit will provide tissue culture cells and the expertise necessary to complete the cellular biology protocols in the individual proposals and 2) The Molecular Biology unit will provide reagents and expertise to complete the molecular biology experiments described in the five projects. Described below are specific details of the primary methods used in Core B. These include, but are not limited to, reverse transcriptase (RT) polymerase chain reaction (PCR), RT real-time PCR, Northern, Southern and Western blot analysis, development of antisense oligonucleotides and siRNAs, subcloning of gene fragments for riboprobe development, and riboprobe synthesis, and targeted gene array analysis. These procedures will be provided to the investigators during the course of the proposed studies as required and new methodologies will be developed as needed. 1) The Tissue Culture Unit The tissue culture component of the Cellular and Molecular Biology Core (Core B) will provide tissue culture cells (both primary cultures and established cells lines) to investigators in individual projects. Primary cultures of cardiac myocytes for Project 1, cardiac fibroblasts and vascular smooth muscle cells for Project 2 will be initiated and maintained in the core facility and provided upon request. Cells will be provided at the level of confluence requested (pre-confluent, confluent or post-confluent) in the types of vessel necessary for individual experiments (in 100 mm Petri dishes and 6, 12 or 24 well cluster plates). Cells will be supplied in regular growth media, serum-free media, or media containing specific test reagents, as required for individual experiments. The phenotype of primary cultures of cardiac and vascular cells will be determined by the staff of the tissue culture facility and documented photographically. In addition, appropriate cells (either primary cultures or established cell lines) will be maintained to monitor the effectiveness of antisense oligonucleotides, siRNAs, or viral vectors to increase or block express of specific proteins. Expertise and reagents for Western blot hybridization, immunohistochemistry and immunocytochemistry also will be available for investigator initiated experiments. Cell Cultures Culture of cardiomyocytes and fibroblasts- Neonatal cardiomyocytes and fibroblasts will be isolated from the ventricles of neonatal Lewis, SHR and WKY rats as previously described (1;2). Briefly, neonatal rats (1-3 days of age) will be euthanized by decapitation following anesthesia with halothane. The hearts will be aseptically removed and the ventricles will be minced into 1 mm3 pieces. The minced tissue will be dissociated with 0.12% trypsin, 0.03% collagenase overnight at 4[unreadable]C. After dissociation, the myocytes will be separated from cardiac fibroblasts by differential adherence. The non-attached viable myocytes will be collected and grown for 48 h on collagen-coated tissue cultures dishes in DMEM/F12 containing 10% fetal bovine serum (FBS), 10 ng/mL insulin, 10 jig/mL holo-transferrin, 100 uM bromodeoxyuridine (to prevent proliferation of non- PHS 398/2590 (Rev. 11/07) Page 396 Continuation Format Page Program Director/PrincipalInvestigator (Last, First, Middle): FeiTariO, CarlOS Maria myocytes), and the antibiotics ampicillin and streptomycin. Subsequently, cardiomyocytes will be incubated in serum-free DMEM/F12 for 48 h, prior to experimentation. Cardiac fibroblasts adherent to tissue culture flasks will be grown in DMEM/F12 containing 10% FBS and antibiotics until confluent. Fibroblasts will be subcultured by trypsinization and used between passages 2 and 4. Isolated cells will be examined routinely by immunocytochemistry using antibodies specific for myocytes (anti-sarcomeric myosin, 1:100, Sigma), vascular smooth muscle cells and myofibroblasts (a-actin, 1:100, Sigma), fibroblasts (fibronectin and vimentin, 1:100, Sigma), and endothelial cells (von Willebrand factor, 1:100, Sigma), as described below. Vascular Smooth Muscle Cells (VSMC) - VSMC will be isolated from the thoracic aorta of 10 to 12 week old Lewis rats (male, 225-250 g) using a procedure previously described by us in numerous publications (3-6;6-8). Briefly, the animals will be decapitated while under anesthesia (2% isoflurane). The thoracic aorta will be aseptically removed, minced into 1 mm2 pieces with a scalpel after removal of the adventitia and the outer third of the medial layer and cultured in DMEM/F12 (1:1) with 10% FBS, 100 (ig/mL penicillin and 100 units/ml streptomycin. The explanted pieces of tissue will be removed after the appearance of a halo approximately ten cells deep around the explant. The growing cells will be fed fresh media and incubated until confluent. The cultures will be incubated in a humidified 37[unreadable]C incubator gassed with 5% CO2 and 95% room air. Subcultures will be developed by treatment with trypsin-EDTA (0.01% trypsin, 0.02% EDTA) in phosphate-buffered saline (PBS;50 mmol/L NaHPO4, 0.15 mol/L NaCI, pH 7.2), at a ratio of 1:5. For serum-free growth conditions, VSMC will be grown in DMEM/F12 containing penicillin, streptomycin (as described above), 0.5 jiM insulin, 5 |ig/ml_ transferrin and 0.2 mM ascorbate but without FBS. This growth media maintains cells in a quiescent, non-catabolic state while promoting the expression of smooth muscle-specific contractile proteins (9). Cells will be identified both morphologically - the appearance of "hills and valleys" and immunocytochemically as VSMC by their expression of VSMC specific-a-actin (Sigma, 1:100), human von Willebrand factor (Sigma; 1:100), or fibronectin (Sigma;1:100) as described below. VSMC will be used between passages 1-4 and are . primarily utilized by the investigators in Project 2. Established Cell Lines - A number of established cells lines (both transformed and non-transformed) are available in the Cellular and Molecular Biology Core. These include: human coronary artery smooth muscle cells (CASMC) from Lanyard, [93-P-2-1] rat proximal tubule cells, NG108-15 neurohybrid cells and NIE 115 neuroblastoma cells (initially obtained from Dr. Marshal Nirenberg at the NIH and used with his permission), various human astrocytoma cells (CRT, STTG1, WIT, and WIN, obtained from Dr. Barbara Barna at the Cleveland Clinic Foundation and used with her permission), EA hy.925 human endothelial cells (obtained from Dr.Cora-Jean S. Edgell at the University of North Carolina at Chapel Hill and used with her permission), RB-1 rabbit vascular smooth muscle cells (obtained from Dr. Maurice Nachtigal at the University of South Carolina School of Medicine and used with his permission), C6 glioma cells, PC12 pheochromocytoma cells, bovine pulmonary artery endothelial cells (PAEC), Madin-Darby canine kidney (MDCK) epithelial cells, Madin-Darby bovine kidney (MDBK) epithelial cells, AR42J pancreatic cells, SK-N-SH human neuroblastoma cells, COS-7 cells and CHO cells (purchased from the American Tissue Culture Collection - ATCC) and QBI-HEK 293A (Stratagene). These cells lines are frozen in cell-specific media containing 10% addition serum and 10% dimethylsulfoxide (DMSO) to maintain their integrity, at either -80 [unreadable]C or in liquid nitrogen. Cells will be thawed and provided to investigators upon request. In addition, primary cultures of astrocytes are routinely prepared from neonatal rat brain (10;11) and could be provided upon request as well as bovine aortic endothelial cells (12). Immunocytochemistry of Cell Cultures Cells will be characterized by immunocytochemistry for the expression of cell-specific proteins. For indirect immunofluorescent microscopy, cells growing on coverslips or chamberslides (coated with polylysine to increase adherence to the glass surface) will be fixed in 4% paraformaldehyde in PBS and permeabilized in 0.1% Triton X-100. Normal goat serum will be added to prevent non-specific binding. Antibodies specific for different types of cells will be obtained from commercial sources and incubated with the cells for 2 h at room temperature or at 4[unreadable]C overnight. The coverslips will be incubated for an additional 30 min in FITC-conjugated PHS 398/2590 (Rev. 11 /07) Page 397 Continuation Format Page Program Director/Principal Investigator (Last, First, Middle): FeiTario, Carlos Maria second antibody (rabbit or mouse;ICN/Cappel;1:200). The coverslips will be washed with PBS, rinsed with water and inverted onto microscope slides containing a drop of glycerol/PBS (50:50). The immunofluorescent products will be visualized using a fluorescent microscope and photographed for documentation. The number of positive cells will be manually counted in a fixed field (using a grid inserted into the observation tube of the microscope) and compared to the total number of fields in the same field to determine the number of contaminating cells in a particular preparation. Immunocytochemistry The rats, anesthetized with a combination of Ketamine/Acepromazine injected intraperitoneally (15 mg Ketamine/0.3 mg Acepromazine/100 g of body weight), will be checked for withdrawal reflex and when the reflex is not exhibited, pinned ventral-side-up on a board. The thorax will be opened at the xiphoid process and along the sides to free the rib cage held by hemostats to expose the heart. A perfusing needle connected to peristaltic pump (DYNAMAX, model RP-1 - Rainin) will be inserted through the apex up to the left ventricle. Phosphate-buffered saline (PBS) will be perfused for 1.5 minutes to clear the blood until the liver is whitened and 4% paraformaldehyde in 0.1M PBS as a fixative will be perfused for 12 minutes. The animal will be decapitated and the brain removed. The tissues of interest will be isolated, embedded in OCT, frozen in dry ice and kept at -80[unreadable]C for storage. Tissue sections (30-35 microns) will be collected in an antifreeze solution (25% glycerol, 25% ethylene glycol and 50% 0.1 M PBS) and kept at -20[unreadable]C. Typically the slices will be placed in 0.1 M PBS to rinse during 30 minutes between every treatment step. Incubation with peroxidase (0.03 - 3% in PBS) will be applied followed by incubation with blocking buffer for one hour (normal serum, Triton and BSA) to minimized endogenous, nonspecific background. The incubation with primary antibody will vary depending on the tissues analyzed and the antibody specificity (hours to overnight) followed by the secondary antibody incubation (typically 45 minutes). The sections will be stained with tertiary avidin-biotin complex (ABC) (ABC Elite Kit,Vector Laboratories) for 30 min at room temperature followed by incubation in DAB to amplify the signal. Slides will be sealed with a mounting media (Cytoseal-60, Richard-Allan Scientific) and in some cases, counterstaining with cresyl violet will be performed to enhance anatomical analysis. For co-localization studies, fluorescent secondary antibodies will be obtained from Jackson ImmunoResearch Labs (West Grove, PA). The primary antibody will be eliminated from the procedure to control for nonspecific effects of the secondary antibody. Post-fixation of tissues will be achieved with 4% paraformaldehyde for 24 h followed by 70% ethanol for 48 h prior to embedding in paraffin. The embedded tissues will be cut into 5 urn thick sections, then deparaffinized in xylene and rehydrated in graded alcohols. If 3,3'-diaminobenzidine (DAB) will be used as the counterstain, then the sections will be incubated in 3% hydrogen peroxide followed by pre-treatment with blocking buffer. Antigen retrieval will be performed as required by incubating tissue sections in 10 mM citrate buffer, pH 6.0, for 35 min in a vegetable steamer. The slides will be cooled for 20 min and placed in distilled water for 5 min. Sections will be incubated in the primary antibody overnight at 4[unreadable]C,rinsed, and incubated with secondary biotinylated antibody for 30 min at room temperature. The sections will be stained with tertiary avidin-biotin complex (ABC) (ABC Elite Kit, Vector Laboratories) for 30 min at room temperature followed by incubation in DAB or Vector Red substrate to amplify the signal. Slides will be washed and counterstained with hematoxylin or hematoxylin-eosin, dehydrated through a series of graded alcohols and cleared using p-xylene, and mounted using Histomount. Stained sections will be visualized and photographed using a video image analysis system (Scion,Inc., Frederick, MD) and public domain software (NIH Image v1.60). A computer assisted counting technique with a grid filter to select cells will be used to quantify the immunohistochemical staining of respective antibodies. The number of immuno-positive cells will be expressed as a percentage of the total cell number examined. Controls will include elimination of the primary antibody to assess the specificity of the staining andpre- incubation with the peptide antigen to determine the specificity of the primary antibody. Media and Reagents PHS 398/2590 (Rev. 11/07) Page 398 Continuation Format Page Program Director/Principal Investigator (Last, First, Middle): FeiTario, CarlOS Maria Routine media and reagents will be purchased from the Tissue Culture Core Laboratory of the Comprehensive Cancer Center of Wake Forest University or for human coronary artery smooth muscle cells (CASMC) from Lanyard. This core facility provides sterile media and reagents, sera and growth supplements, and antibiotics, on a fee-for-reagent basis. The reagents are routinely purchased from Gibco/BRL or Sigma and the staff of the facility prepares the specified media upon request. In addition, the core provides testing for mycoplasm on a fee-per-test basis. We routinely monitor our cell lines and primary cultures for contamination by mycoplasm (allcell lines and periodic checks of primary cultures). If any contamination is detected, the infected cell lines or primary cultures are discarded. Several reports in the literature showed that mycoplasm or mycoplasm-contaminated cells contain Ang II receptors with a relatively high affinity for Ang-(1-7), as reviewed in (13). Antibodies for Immunocytochemistry and Western Blot Hybridization Many projects use antibodies for immunocytochemistry and Western blot hybridization that are unique to their experiments. A description of these antibodies, their sources, and the detailed procedures for their uses are described within the individual projects. However, a number of antibodies are used by multiple investigators and will be maintained in stock by the Cellular and Molecular Biology Core, A description of these antibodies and their source are described in the table below. Secondary antibodies for Western blot hybridization will include the appropriate horseradish peroxidase-coupled sheep anti-mouse or anti-rabbit antibodies (ECL antibodies from Amersham), for fluorescence microscopy will include FITC-coupled goat anti- mouse or anti-rabbit antibodies (from ICN/Cappel), and for immunocytochemistry will include biotinylated horse or goat anti-rabbit or anti-mouse antibodies. The dilutions of each primary and secondary antibody will be determined for individual experiments. Antibodies prepared by injection of specific peptides will be affinity purified, as described below, and the specificity will be determined by incubating the antibody with the peptide to which it was raised, whenever possible. Antibodies prepared by injection of peptides will routinely be purified by peptide-affinity chromatography, as originally described for the Ang-(1-7) antibody (14). Peptide affinity columns will be prepared by coupling 5 mg of the purified peptide to 1 mL of Affi-Gel 10, according to the manufacturer's directions. This procedure routinely couples 70 to 80% of the peptide to the affinity matrix. DEAE-cellulose will be used to remove serum proteins from whole serum (1 mL DEAE-cellulose/mL whole serum) prior to affinity chromatography, DEAE-cellulose purified serum will be mixed with the affinity matrix overnight at 4[unreadable]C using a rotary mixer. The purified antibody will be eluted from the column with 50 mM glycine, 50 mM HCI, pH 2.2, following extensive washing with phosphate-buffered saline. The eluant will be immediately neutralized with 1 M Tris, such that the final concentration of the eluted protein is 50 mM Tris-HCI, pH 7.4. Affinity-purified antibodies will be stored at -80 [unreadable]C in small aliquots. Table 1. List of the antibodies currently available in Core B Angiotensinogen Humanangiotensinogen Rabbit Angiotensinogen N and C terminal peptides Rabbit Renin Mouse submandibular gland Mouse ACE Rat lung Mouse ACE2 N and C terminal peptides Rabbit Renin Hog Renin Rabbit Ang-(1-7) Peptide Rabbit Ang-(1-12) Peptide Rabbit i receptor Peptide Rabbit AT2 receptor Human (peptide) Rabbit PHS 398/2590 (Rev. 11/07) Page 399 Research Diagnostics Inc. Custom made for us byAnaspec Research Diagnostics Inc. Research Diagnostics Inc. Custom made for us byAnaspec Gift from T. Inagami Custom made for us byAnaspec Custom made for us byAnaspec Research Diagnostics Inc. Research Diagnostics Inc. Continuation Format Page Program Director/Principal Investigator (Last, First, Middle): FerrariO, CarlOS Maria mas Rat (peptide) Rabbit PI3K Human PI3Kp110a Rabbit AKt C-t mouse Akt Rabbit PKC-a Human PKCi;Rabbit COX2 C-t murine rat COX2 Rabbit COX1 Ovine COX1 Mouse Prostaglandin E synthase Human mPGE amino acids 59-75 Rabbit GPR-30 Human C-t domain Rabbit HNE 1:1 aa HNE Michael adducts reduced Rabbit Estrogen Receptor Human hinge region (287-300 aa) Rabbit Estrogen Receptor(3 Rat C467-487 ER (3 Rabbit Neprilysin Rat Neprilysin Rabbit CTGF Mouse amino acids 223-348 CTGF Rabbit IGF-1 Small molecule (trimtrophenol) Mouse NOX-4 Human amino acids 100-200 NOX4 Rabbit Thromboxane synthase Human amino acids 359-377 Rabbit Prostaglandin I synthase Bovine amino acids 299-329 Rabbit Prostaglandin D synthase Human PGDS peptide Rabbit VEGF Human amino acids 1-140 Rabbit Flt1 Human C-terminus of Fill Rabbit VEGF receptor 2 Mouse C-terminus of FLK1 Rabbit Phospho-p38 Phospho-peptide of human p38 Rabbit PTP1b Peptide to human PTP1b Rabbit DUSP1 Peptide to human DUSP1 Rabbit Phospho-AKT Phospho-peptide of mouse AKT Rabbit eNOS Human eNOS amino acids 1 1 81 -11 94 Rabbit nNOS Human nNOS Mouse Soluble guanylate cyclase rat (31 subunit amino acids 188-207 Rabbit Phospho-ERK1 Phospho-peptide of human p44 Rabbit Phospho-MEK1/2 Phospho-peptide of human MEK1/2 Rabbit Phospho-JNK Phospho-peptide of human JNK Rabbit EGF receptor Human EGF receptor C-domain Rabbit Nucleoporin Human nucleoporin Mouse PTEN Human PTEN C-terminal sequence Rabbit PP2A Human sequence of subunit a Rabbit TGFpl Human protein Mouse ED1 Rat spleen cells Mouse CTGF Peptide of mouse protein Rabbit Ki67 Peptide of human protein Rabbit Custom made for us by Anaspec Cell Signaling Cell Signaling Cell Signaling Cayman Oxford Biomedical Research Cayman MBL Calbiochem Stressgene ABR Affinity Bioreagents Chemicon Abeam Abeam Abeam Cayman Cayman Cayman Santa Cruz Biotechnologies Santa Cruz Biotechnologies Santa Cruz Biotechnologies Cell Signaling Abeam Upstate (Millipore) Cell Signaling Upstate (Millipore) BD Biosciences Transduction Cayman Cell Signaling Cell Signaling Cell Signaling Cell Signaling BD Biosciences Transduction Cell Signaling Cell Signaling R&0 Chemicon Abeam Abeam Additional antibodies from commercial sources or custom synthesis will be obtained for use by the group as required. For example, the anti-Ang-(1-12) antibody recently was procured as a tool to characterize this novel propeptide. The antibody was generated in rabbits by AnaSpec using covalent coupling of the N- terminus of rat Ang-(1-12) via a cysteine residue (*Cys-Asp1-Arg2-Val3-Tyr"-lle5-His6-Pro7-Phe8-His9-Leu10- Leu11-Tyr12) to keyhole limpet hemocyanin (KLH) as described for the Ang-(1-7) antibodies (18). The peptide- KLH conjugate was emulsified in Freunds'adjuvant and administered subcutaneously over 2 months. The IgG fraction was purified on a Protein A column prior to injection or infusion. Rat Ang-(1-12) will be iodinated using chloramine T and purified by high pressure liquid chromatographyto remove the non-labeled peptide (18), and competition curves were performed with Ang-(1-12) as well as other angiotensins to determine the specificity of PHS 398/2590 (Rev. 11/07) Page 400 Continuation Format Page Program Director/Principal Investigator (Last, First, Middle): FeiTariO, CarlOS Maria the antibody. A 0.01% cross-reactivity with Ang I and less than 0.001% cross-reactivity with Ang II were observed with the Ang-(1-12) antibody. These data demonstrate the high specificity of the Ang-(1-12) antibody for the C-terminal sequence (Leu11-Tyr12) of the peptide. Angiotensin RIAs will be used to verify peptide stability in the osmotic infusion pumps for the duration of the proposed physiology studies. 2) The Molecular Biology Unit The primary function of the molecular biology unit of Core B will be to develop and implement methodologies to monitor or regulate gene expression, as needed in specific projects. RT real-time PCR assays will be employed to detect gene-specific mRNAs and Western blot hybridization will be used to detect specific proteins in tissues or cultured cells. The core personnel will develop and test antisense oligonucleotides, siRNAs, or shRNAs to reduce specific gene expression as well as generate recombinant constructs to overexpress or knockdown target genes. The Molecular Biology Core laboratory periodically will determine the direct genetic status of transgenes in colony breeding stocks. In addition to the development and performance of assays, the Molecular Biology Core will serve as a major source for information exchange, consultation, and instruction directed to the principal investigators and technical staff of the involved projects. Described below are some of the molecular biology techniques provided by the Molecular Biology Core. It should be noted that new methodologies are developed continually as needed by the Project Leaders. Reverse Transcriptase (RT) Real-time Polymerase Chain Reaction (PCR) Assay RT real-time PCR assays will be used to analyze biopsy samples from candidate tissues or cultured cells to detect or quantify gene-specific mRNAs. In this procedure, first strand cDNA copies of the mRNA molecules in the sample are produced using reverse transcriptase with random hexamer primers. Paired oligonucleotide PCR primers and a fluorescent-labeled probe specific for the cDNA of interest are then added and the mixture incubated in a real-time thermal cycling protocol. RNA will be isolated from tissue or cultured cells, using the TRIZOL reagent (GIBCO BRL), as directed by the manufacturer. Approximately 50-100 mg of tissue will be homogenized in 1.0 ml of the TRIZOL reagent. Three mL of the reagent will be added to one dish (100 mm) of cultured cells. In both cases, the resultant samples will be extracted with chloroform and the RNA will be precipitated with isopropanol. The RNA will be isolated by centrifugation at 10,000 x g for 10 min at 4[unreadable]C. The pellet will be washed with 75% ethanol, dried, and then re-dissolved in 30 ^L diethylpyrocarbonate (DEPC)-treated water. The RNA concentration and integrity will be assessed using an Agilent 2100 Bioanalyzer with an RNA 6000 Nano LabChip (Agilent Technologies, Palo Alto, CA). The isolated RNA will be incubated with RQ1 DNase (Promega) to eliminate any residual DNA that will amplify during the PCR. Approximately 1 ng of total RNA will be reverse transcribed using AMV reverse transcriptase in a 20 ^L reaction mixture containing deoxyribonucleotides, random hexamers and RNase inhibitor in reverse transcriptase buffer. Heating the reverse transcriptase reaction product at 95CC will terminate the reaction. For real-time PCR, 2 jaLof the resultant cDNA will be added to TaqMan Universal PCR Master Mix (Applied Biosystems, Foster City, CA) with the appropriate gene-specific primer/ probe set and amplification will be performed on an ABI 7000 Sequence Detection System. The primer/probe sets will be purchased from Applied Biosystems or will be designed by core personnel and synthesized by Applied Biosystems. The mixtures will be heated at 50[unreadable]C for 2 min, at 95[unreadable]C for 10 min followed by 40 cycles at 95[unreadable]C for 15 sec and 60[unreadable]C for 1 min. All reactions will be performed in triplicate and 18S ribosomal RNA, amplified using the TaqMan Ribosomal RNA Control Kit (Applied Biosystems), will serve as an internal control. The results will be quantified as Ct values, where Ct is defined as the threshold cycle of PCR at which amplified product is first detected, and defined as relative gene expression (the ratio of target/control). PHS 398/2590 (Rev. 11/07) Page 401 Continuation Format Page Program Director/Principal Investigator (Last, First, Middle): FerrariO, CarlOS Maria In the development of each RT-PCR assay, optimum amplification conditions and reagent concentrations are carefully determined. Standard RT Real-Time PCR Assay Controls [unreadable] In our assays, any variations in reverse transcription or amplification efficiency, RNA degradation, pipetting, or sample loading are detected by the co-transcription and amplification of a positive control 18S rRNA, because quantification is expressed as Ct values, where Ct is defined as the threshold cycle of PCR at which amplified product is first detected, and defined as relative gene expression (the ratio of target/control). [unreadable] As the laboratory maintains plasmid stocks containing the genes for the majority of the RAS components as well as a number of subclones used to produce riboprobes, a complementary reverse transcriptase minus reaction is always run for every sample to ensure that the signals obtained are not due to contaminating DMA. [unreadable] The amplification of the target mRNA in a control tissue or cell type is also included in every assay protocol. For example, total RNA isolated from adrenal tissue is used as a control for the rat angiotensin receptor mRNAs. Since the PCR reagents are prepared as a master mix and added to the samples, this ensures that a negative amplification is not due to an error in the reaction mixture preparation. [unreadable] Care is taken to prevent contamination of the samples. Standard precautions, such as the use of filter- stuffed pipet tips and cleaning with decontamination solutions, are strictly monitored. The following RT real-time PCR assays were optimized and are currently available in Core B. New assays are added as required by investigators. Table 2. List of the RT-PCR assays currently performed in the Molecular Biology unit of Core B. Gene Gene Name Species Ace angiotensin I converting enzyme Rat, Human, Mouse Ace2 angiotensin I converting enzyme2 Rat, Human, Mouse Adam17 tumor necrosis factor, alpha, converting enzyme Rat, Human AgtrlAR angiotensin II receptor, type1A Rat, Human, Mouse AgtMAR angiotensin II receptor, type1A Rat, Human, Mouse AgtMBR angiotensin II receptor, type IB Rat Agtr2 angiotensin II receptor, type 2 Rat, Human, Mouse Agtrh angiotensin receptor-like 1 Rat Aogen angiotensinogen (serpin peptidase inhibitor) Rat, Human APAF1 apoptotic peptidase activating factor 1 Human Aqp1 aquaporin 1 Rat Aqp2 aquaporin2 Rat BIRC5 (survivin) baculoviral IAP repeat-containing 5 Human Casp3 caspase 3, apoptosis-related cysteine peptidase Rat, Human Casp9 caspase 9 Rat CDK4 cyclin-dependent kinase 4 Human CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cipl) Human Cdknlb cyclin-dependent kinase inhibitor IB (p27, Kipl) Rat, Human CDKN2A cyclin-dependent kinase inhibitor 2A Human Collagen1-JUNC collagen"! Rat Connexin43 (GJA1) gap junction protein, alpha 1, 43kDa Rat, Human Cyp11b2 (aldosterone) cytochrome P450, family 11, subfamily B, polypeptide 2 Rat PHS 398/2590 (Rev.11/07) Page 402 Continuation Format Page Program Director/Principal Investigator (Last, First, Middle): FerrariO, Carlos Maria Duspl dual specificity phosphatase 1 Rat, Human Dusp6 dual specificity phosphatase 6 Rat, Human Esr1 estrogen receptor 1 Rat Esr2 estrogen receptor 2 Rat Ferritin(FTHI) ferritin, heavy polypeptide 1 Human Flt1 FMS-like tyrosine kinase 1 Rat Fn1 fibronectin 1 Rat Gss Glutathione synthetase Rat Gp91phox/cybb cytochrome b-245, beta polypeptide Rat Gpr30 G protein-coupled receptor 30 Rat Iaf1 insulin-like growth factor 1 Rat IRS2 insulin receptor substrate 2 Rat Kdr(VEGFR2) kinase insert domain protein receptor Rat Kim1 kidney Injury molecule 1 Rat Lepr leptin receptor Rat MAP2K5 (MEK5) mitogen-activated protein kinase kinase 5 Human MapkH (p38) mitogen activated protein kinase 14 Rat Mas MAS1 oncogene Rat, Human MEF2C myocyte enhancer factor 2C Mme (Neprilysin) membrane metallo endopeptidase Rat Mmp9 matrix metallopeptidase 9 Rat Nos1 nitric oxide synthase 1, neuronal Rat, Human, Mouse Nos2 nitric oxide synthase 2, inducible Rat, Human, Mouse Nos3 nitric oxide synthase 3, endothelial cell Rat, Human, Mouse Nox4 NADPH oxidase 4 Rat, Human Nphsl nephrosis 1 homolog, nephrin (human) Rat Nphs2 nephrosis 2 homoloq, podocin (human) Rat Nr3c2 (mineralcorticoid) nuclear receptor subfamily 3, group C, member 2 Rat Pik3r1 phosphatidylinositol 3-kinase, reg. subunit, polypeptide 1 Rat Pik3r1 reg subunit natriuretic peptide precursor type A Rat Plac.GF (PLGF) placental growth factor Human PPP2R5A phosphatase 2, req. subunit B1, alpha isoform Human Ptges prostaglandin Esynthase Rat, Human Ptgis prostaglandin 12 (prostacyclin) synthase Rat, Human Ptqsl (Cox1) prostaglandin-endoperoxide synthase 1 Rat, Human Ptgs2 (Cox2) prostaglandin-endoperoxide synthase 2 Rat, Human PtpnKPtPlb) protein tyrosine phosphatase, non-receptor type 1 Rat RatENOS-J1 nitric oxide synthase 3, endothelial cell Rat Rln1 relaxin 1 Rat Renin renin Rat, Human SOD1 superoxide dismutase 1 Rat Tbxasl thromboxane A synthase 1 Rat TGF beta transforming growth factor, beta 1 Rat THBS thrombospondin 1 Human VEGF vascular endothelial growth factor A Rat, Human VEGI/TNFSF15 tumor necrosis factor, super family 15 Human VEGI/TNFSF15 tumor necrosis factor, super family 15 Human Genotype Analysis A PCR analysis of DMA isolated from an ear punch biopsy specimen was developed in the molecular PHS 398/2590 (Rev. 11/07) Page 403 Continuation Format Page Program Director/PrincipalInvestigator (Last, First, Middle): FerrariO, CarlOS Maria biology core to identify the mouse ren-2 transgene in production littermates for both mRen2(27) transgenics and mRen2.Lewis congenics. The biopsy (approximately 2 mm) will be obtained in a clean area near the breeding facility with lidocaine for local anesthesia. The tissue will be digested in a 20 jiL solution of Proteinase K (1.0 mg/mL) in digestion buffer (50 mM Tris-HCI, pH 8, 20 mM NaCI, 1 mM EDTA and 1% sodium dodecyl sulfate) at 55[unreadable]C for 1 h with mixing every 15 min. The sample will be added to 180 pL of sterile water and then heated to 100[unreadable]C for 5 min. Two ^L of the resultant mixture will be added to 48 |al_ of an amplification solution containing 0.2 mM dNTPs, 1.5 mM MgCI2, 1.0 jaM mouse/rat renin forward primer (CAAAGTCATCTTTGACACGG), 1.0 ^M mouse renin reverse primer (AGTCAGAGGACTCATAGAGG), 1.0 |iM rat renin reverse primer (ATTCCGAGGAGTCATAGAGG) and 1.5 units of Taq DMA polymerase, in Taq reaction buffer. The 5'(forward) primer which is an identical sequence in the mouse and rat and the unique mouse and rat 3'(reverse) primers hybridize to complementary sequences in exon 3 and exon 4 of their respective renin genes (15;16). A standard PCRreaction (denaturation - 94[unreadable]C, 20 s, annealing - 55[unreadable]C, 45s, elongation - 72[unreadable]C, 90 s for 30 cycles with a final elongation step of 10 min at 72[unreadable]C) yields fragments differing in size by 90 base pairs between the inserted mouse Ren-2 gene and the rat renin gene. As described in Project 5, two transgenic rat strains will be obtained, one with a human renin insert and the other with an angiotensinogen insert. Cross-breeding these two homozygous strains will produce a double transgenic animal harboring both human genes. A genotype assay will be developed prior to the arrival of the animals to ensure the phenotype of the breeding pairs. Targeted Array Analysis Core B offers targeted gene array analysis using SuperArray B

View original record on NIH RePORTER →