GGrantIndex
← Search

The Role Of Nrf2 In Susceptibility To Hyperoxic Lung Injury

$310,637Z01FY2008ESNIH

National Institute Of Environmental Health Sciences

Investigators

Linked publications, trials & patents

Abstract

Microarray analysis of lungs from Nrf2-/- and Nrf2+/+ mice exposed to O2 found that Nrf2 modulates expression of Pparg (peroxisome proliferator-activated receptor-gamma, PPAR-g). PPARs belong to a nuclear hormone receptor superfamily, and the therapeutic potential of PPAR agonists (e.g., Rosiglitazone) has been recently elucidated in pathologic conditions such as inflammation and immunity, cancers, and metabolic disorders (e.g., type 2 diabetes, dyslipidemia, obesity). To evaluate the role of PPAR-g as a downstream effector of Nrf2 in protection against acute lung injury, we exposed Nrf2+/+ and Nrf2-/- mice to O2 and found significant suppression in pulmonary nuclear translocation and DNA binding activity of PPAR-&#61543; basally and after O2 in Nrf2-/- mice compared to Nrf2+/+ mice. In collaboration with Dr. Douglas Bells group, we identified 9 potential ARE sequences in 2 kb upstream promoter of Pparg for putative Nrf2 binding (see below for greater detail on this procedure). Nuclear protein binding activity of an ARE spanning -784 and -764 (TCATTGTGACATAGCACTTAT) was significantly lower in Nrf2-/- than in Nrf2+/+ mice. Mutations in this ARE diminished Nrf2 binding. Moreover, its deletion significantly suppressed promoter activity in cells overexpressing Nrf2 after O2 exposure. Furthermore, intratracheal delivery of small interfering RNA (siRNA) specific for PPAR-g significantly enhanced lung inflammation and epithelial proliferation compared with mice treated with control siRNA. Results thus suggest that PPAR-g contributes significantly to pulmonary protection from oxidant-induced inflammation and injury, and Nrf2 may modulate it through ARE binding.[unreadable] [unreadable] To better understand the mechanisms of Nrf2 interaction with target genes, we have begun to investigate the effect of polymorphisms in the Nrf2 promoter binding site ARE, a cis-acting enhancer sequence found in the promoter region of many genes that encode antioxidant and Phase II detoxification enzymes/proteins. SNPs in transcription factor binding sites (TFBSs) may affect the binding of transcription factors, lead to differences in gene expression and phenotypes, and therefore affect susceptibility to environmental exposure. In collaboration with Drs. Douglas Bell, Xuting Wang, and Brian Chorley, we developed an integrated computational system for discovering functional SNPs in TFBSs in the human genome and predicting their impact on the expression of target genes. In this system, we (i) constructed a position weight matrix (PWM) from a collection of experimentally discovered TFBSs; (ii) predicted TFBSs in SNP sequences using the PWM and map SNPs to the upstream regions of genes; (iii) examined the evolutionary conservation of putative TFBSs by phylogenetic footprinting; (iv) prioritized candidate SNPs based on microarray expression profiles from tissues in which the transcription factor of interest is either deleted or over-expressed (e.g. our microarray studies described above) and (v) finally, analyzed association of SNP genotypes with gene expression phenotypes. The application of our system has been tested to identify functional polymorphisms in the ARE. Using our novel computational tools, we have identified a set of polymorphic AREs with functional evidence, showing the utility of our system to direct further experimental validation of genomic sequence variations that could be useful for identifying high-risk individuals.[unreadable] [unreadable] We hypothesized that polymorphisms in NRF2 resulting in decreased function similarly predispose humans to ALI. To address this hypothesis, we first resequenced NRF2 in four different ethnic populations and identified three new NRF2 promoter polymorphisms at positions -617 (C/A), -651 (G/A) and -653 (A/G). Transcription factor motif analysis (TRANSFAC) indicated that variations at -653/-651 and -617 alter the consensus recognition sequences for MZF-1 (Myeloid zinc finger-1) and NRF2, respectively, suggesting that these polymorphisms may affect NRF2 transcription. To examine this concept, we transiently transfected the 727-Luc (-617C allele) and 538-Luc (which lack the polymorphisms) into A549 cells and basal level activity of the NRF2 promoter with or without polymorphisms was determined. Compared to the basic pGL3-vector, the 538-Luc displayed significantly higher level of activity (p < 0.001). The -538 to +131 bp region of NRF2 (538-Luc) contains regulatory elements that drive the promoter activity above the levels seen with the promoter-less basic vector. However, the inclusion of -538 to -727 region to the 538-Luc construct further enhanced the reporter activity. These results indicate that the -538 to +131 bp region acts as a basal promoter, while the -538 to -727 region acts as an enhancer. Relative to 538-Luc, the 727-Luc reporter had four-fold higher luciferase activity (p < 0.001) indicating that the -538 to -727 region most likely contains DNA sequences required for high level NRF2 promoter activity. Finally, we tested the association of functional SNPs (-617, -651) with differential risk for ALI in patients following major trauma. Patients with the -617 A SNP had a significantly higher risk for developing ALI after major trauma OR 6.44; 95% CI 1.34, 30.8; p = 0.021 relative to patients with the wildtype (-617 CC). This translational investigation provides novel insight into the molecular mechanisms of susceptibility to ALI, and may help to identify patients who are predisposed to develop ALI under at risk conditions, such as trauma and sepsis. Furthermore, these findings may have important implications in other oxidative stress related illnesses. [unreadable] [unreadable] A major target gene for NRF2 is NAD(P)H:quinone oxidoreductase 1 (NQO1). NQO1 is involved in the formation of reactive oxygen species and other free radicals. NQO1 catalyzes the two-electron reduction of a variety of quinone compounds, which prevents the generation of free radicals and reactive oxygen species, and protects cells from oxidative damage. NQO1 expression is induced by oxidant stress, aromatic hydrocarbons, phenols, and certain industrial acrylates and metals. The role of NQO1 in ALI has not been investigated, but the effects of modulation of NQO1 activity in preliminary studies suggest that alterations in its function could enhance lung injury. The overall objective of this investigation is to identify and evaluate functionality of NQO1 promoter SNPs, and determine whether SNPs with in vitro evidence of function are associated with differential risk for ALI in patients who have experienced major trauma. We identified three novel NQO1 promoter SNPs (-1103, -1221, -1293) for investigation based on potential functional relevance and frequency in the population; their function was unknown. Luciferase constructs containing the wild-type NQO1 promoter, and promoters containing SNP -1293 A, -1221 C, or -1103 G were transfected into BEAS-2B bronchial epithelial cells and exposed to hyperoxia, H2O2, BHT, or LPS. Interestingly, the A/C SNP at -1221 decreased in vitro transcription of NQO1 at baseline and after exposure to the oxidant stressors. We have also found in initial analyses of a blunt force trauma cohort that patients heterozygous for the -1221 C allele were at significantly lesser risk of ALI after major trauma compared with patients with wild type alleles, even after adjustment for race, APACHE III score, and mechanism of trauma OR, 0.46 (95% CI, 0.23, 0.90); p = 0.024. We believe that continuation of this investigation will provide valuable insight to the role of NQO1 in ALI and other diseases with oxidative stress etiology.

View original record on NIH RePORTER →