FETAL MEMBRANE MATRIX METALLOPROTEINASES IN MONKEYS SPONTANE &ACTH INDUCE LABO
Oregon Health And Science University, Portland OR
Investigators
Linked publications & trials
Abstract
The preovulatory release of gonadotropin-releasing hormone (GnRH) and luteinizing hormone (LH) in women and rhesus monkeys is dependent upon enhanced secretion of ovarian estradiol-17? (E). This E-induced GnRH/LH surge is accompanied by changes in hypothalamic and brainstem cells that are identified as neuropeptide Y (NPY)-, norepinephrine (NE)-, acetylcholine (Ach)- and gamma aminobutyric acid (GABA)-containing neurons. Our research has focused on how E influences transcriptional-translational events associated with these peptide and transmitter systems and how these central neural events change with aging, especially the perimenopausal life-stage where E secretion declines. Two isoforms of the E receptor (ER ? and ?) have been reported. To study the tissue distribution of the ER isoforms, we cloned and sequenced two cDNA probes (126 bp and 291 bp) for rhesus monkey ER-?. These cDNA fragments were similar, but not identical, to human ER-? sequences. With pro bes for bo th ER-? and ER-?, we quantified the ER isoforms in several peripheral and central neural male and female tissues by reverse transcription-polymerase chain reaction (RT-PCR). Both the ER-? and ER-? mRNAs were present in male and female reproductive organs. Only ER-? was expressed in liver, frontal cortex, caudate nucleus, locus coeruleus and cerebellum. In some brain regions, i.e., the putamen, internal capsule, hippocampus and paraventricular hypothalamus, ER-? was expressed in the female, but not in the male. In macaque females 10-15 years of age mRNA expression for tyrosine hydroxylase (TH, enzyme for control of NE synthesis) in specific adrenergic neural populations (A1, A2, A6) are upregulated by E treatment. However, after E treatment in perimenopausal monkeys (> 22 years old), expression levels of TH mRNA is dampened in the A6 region of brainstem. We continue to study the relevance of this age- and E-related decline in TH mRNA response in brainstem neurons. We also cloned a 356 bp monkey choline acetyltransferase (CHAT, the enzyme for control of Ach synthesis) cDNA fragment that corresponds to the human CHAT N-1 type sequence 332 to 684. The 5= and 3= primer sequences were TAAGATGGCAGCAAAAACTCCC and ACCGATGACCAGCTGAGGTTT, respectively. To our knowledge, this partial DNA sequence of the rhesus monkey CHAT gene has not been documented previously. The MCHAT RNA probe that was generated from the clone hybridized with CHAT mRNA in several specific hypothalamic and brainstem areas in adult female macaque brain. Quantification of mRNA expression during various physiologic conditions will help establish the relevance of cholinergic neurons during ovulation and anovulation in primates. FUNDING NIH HD16631, HD18185 PUBLICATIONS Pau CY, Pau KYF, Spies HG. Putative estrogen receptor and a mRNA expression in male and female rhesus macaques. Mol Cell Endocrinol 146:59-68, 1998.
View original record on NIH RePORTER →