Enzyme Structures And Proteins Of Innate Immunity
Diabetes, Digestive, Kidney Diseases
Investigators
Linked publications, trials & patents
Abstract
1. Deoxyhyposine synthase The crystal structure of the enzyme Deoxyhypusine synthase has been determined at 2.2A resolution. The enzyme is a homotetramer consisting of two pairs of closely linked subunits with the active sites shared between the subunits. The active site is located in a deep cavity in which the spermidine is presumably bound. The nicotinamide ring is oriented in a manner consistent with the established stereospecificity of the hydride reaction. One interesting feature of the structure is that there is an N- terminal helix from a third subunit that forms a ball and chain arrangement which is located so as to block access to the active site. A new crystal form of the enzyme reveals that the access to the active site pocket is now open with the N-terminal helices disordered. Spermidine analog inhibitors have been demonstrated to bind in the pocket. 2.The immune response to microbial pathogens relies on both innate and adaptive components. A primary challenge to the innate immune system is the discrimination of a large number of potential pathogens from self, with the use of a restricted number of receptors. This challenge has been met by the conserved motifs on pathogens that are not found in higher eukaryotes. A key step in understanding innate immunity was the recent discovery of the mammalian homologue of the drosophila Toll receptor, the toll like receptor (tlr). The tlr is a transmembrane receptor with an extracellular domain containing multiple leucine-rich repeats (LRR), while the intracellular domain is similar to the intracellular domain of the IL-1 receptor (IL-1R) and these regions are referred to as Toll/IL-1R (TIR) domains. However, at present little is known about the three-dimensional structures and interactions of the toll like receptor and its associated proteins (CD14, MD2 and MyD88). LRR, TIR, MD2 and MyD88 have been cloned into various expression vectors (pET, pPicZaA and pBac) and are currently being tested in a variety of protein expression systems such as bacterial (E. coli), yeast (Pichia pastoris) and insect (baculovirus). The ultimate goal will be the determination of the three dimensional x-ray crystal structures of the tlr and associated proteins. The structural information obtained from these studies will provide vital information about the interaction of tlr and its associated proteins, and will lead to a greater understanding of innate immunity. 3. Rob/DNA/4,4'-Dipyridyl. We have been investigating possible conformational changes that take place in the trancriptional activator, Rob, in the presence of dipyridyl. So far this protein has been tested for crystallization with the two published DNA sequences. Originally, TGACAGCACTGAATGTCAAAG was crystallized with ROB while CCGATGCCACGTTTTGCTAAATCC was crystallized with MarA. First, gel-shift assays were performed to characterize optimal salt concentrations for DNA binding. The protein binds DNA best at neutral pH and when the salt concentration is less than 50mM. However, the range of pH for good binding is very large. Both original crystallization conditions and all the previously mentioned crystallization screens were tested for the protein/DNA complexes in the presence of 4,4'-Dipyridyl (or DP).
View original record on NIH RePORTER →