GGrantIndex
← Search

NMR DETERMINATION OF POXVIRUS DNA BULGED STRUCTURE

$273,230P41FY2001RRNIH

University Of California San Francisco, San Francisco CA

Investigators

Linked publications & trials

Abstract

We are determining the high resolution structures of two naturally occurring vaccinia virus DNA segments containing extrahelical bases by NMR. Each segment contains two extra bases (G and C) on the same strand, separated by d(AA).d(TT). The sequences appear in the vaccinia genome as reverse complements, one near each terminus, with the extrahelical bases at corresponding but complementary locations. Our strategy is to synthesize two 29mers: 5'CCTAATTATAACGAAGTTAGTACATTAGG3' and 5'CCTAATGTACTAACGAAGTTATAATTAGG3'. We are also synthesizing and determining the structures of control oligonucleotides lacking either or both of the extrahelical bases. The two 29mers contain the viral DNA sequences, with the terminal d(AT) base pairs having been replaced by d(GC) pairs and a trinucleotide linker GAA having been added to permit formation of a stem/loop. This will reduce the effects of fraying as well as overlap in the NOESY signals, avoid the necessity of forming a duplex by mixing single strands, and improve overall stability. We will determine the DNA stem/loop structures with restrained molecular dynamics, using MARDIGRAS, based upon both NOE-derived proton-proton distances and relaxation matrix-calculated NOESY cross peak volumes in both D2O and H2O. MidasPlus and Sparky are central to our work in assessing structural features such as the extent of pairing of the two AT base pairs between the extrahelical bases and the looping out or stacking of the extrahelical bases themselves.

View original record on NIH RePORTER →